Поиск леталей и полулеталей. Методы селекции мутаций у Drosophila. Мёллер 5: летали и др. мутации в Х-хромосоме.


Чтобы посмотреть этот PDF файл с форматированием и разметкой, скачайте его и откройте на своем компьютере.
Генетика клеточного
цикла
Электронно-лекционный курс
Глава 6
Методы обнаружения мутаций клеточного цикла
у
Drosophila
Мутации, связанные с воспроизводством клеток, чаще всего
летальны.
Отбор стерильных особей и их исследование на дефекты мейоза
Поиск леталей и полулеталей

Методы селекции мутаций у
Drosophila
Мёллер 5: летали и др. мутации в Х-хромосоме
y M5
y M5
y M5
X
y M5

леталь

леталь
X
y M5
y M5
y M5

леталь
любая леталь
Мутации в гаметах
y M5
Выведение
хромосомы на
уровень
организма
Методы селекции мутаций у
Drosophila
Нерасходения хромосом в мейозе
-
мутации
mei

M5

M5

M5
X

M5

y
X


y pn v

y m
y m
Мутации в гаметах
y+
Выведение
хромосомы на
уровень
организма
y+
y pn v
X
Размножение
мутантной хромосомы






Индивидуальные
скрещивания
«Летали» погибают,
«слабые дефекты»
выживают
y pn V
y pn V
0
y+
y pn v
y pn v
y+
y+
y+
y pn V
y pn V
0
y+
y+
y pn V
y pn V
y pn V
y pn V
y+
y+
Нерасхожд.
в М1
Нерасхож.
в М2
y
y
y
y
y
y
y
y
pn, v
y,pn,v
y,pn,v
,pn,v
y
y
Поиск мутагенчувствительных мутаций.
Мутации, нарушающие репарацию-
mus
Мутации, в гомозиготе вызывающие гибель личинок на среде с
мутагеном (этилметансульфонат), не вызывают гибели без мутагена
w
y Basc mal
y Basc mal
y Basc mal
y Basc mal
y Basc mal
w
w
w
y Basc mal
y Basc mal
y Basc mal
ЭМС
х
х
индивидуально
Метод поздних леталей.
Нашли мутагенчувствительную леталь, гибнущую в 3-м
личиночном возрасте (возникают множественные разрывы
хромосом)
Линия, позволяющая получать гомозиготы по поздним леталям
Инсерция Р-элемента, содержащего ген
у+,
в балансер
CyO
(2-
я
хромосома):
y w; l(2) / P{y+} CyO
y+
у личинок серые щетинки и черные челюсти
,
y -
у личинок коричневые щетинки и желтые челюсти
y w

l(2)

l(2)

l(2)
Cy O y+
Cy O y+
Cy O y+
Личинки живут, нет имаго


поздняя леталь
Ранняя леталь
Жизнеспособные личинки и мухи
y w
y w
3-я хромосома маркирована генами клеточного деления:
gnu, polo, mgr, asp, stg
Хромосома,
обработанная мутагеном
Обнаружены :

аллели всех мутаций,

новые мутации, проявляющие
летальное взаимодействие с
этими генами
Поиск мутаций по взаимодействию с
определенными генами

синтетическая леталь
gnu- Giant nuclei
asp- abnormal spindle
mgr- merry go round
stg- string
- протеинфосфатаза,
гомолог
cdc25 S.pombe
polo-
серин-треонин-
протеинкиназа, Полюс веретена.
Монополярное веретено
Тест на
летальность
Получение мутаций инсерцией Р-элемента
Ловушка энхансеров
P{lArB}
X
P{
ry+
Δ
2-3}
TM3,Sb
P{lArB}
CyO
P{ry+
Δ
2-3}
TM6,Tb ry
+
If
+
P{lArB}
If
TM6,Tb ry
X
ry
ry
ry
TM6,Tb ry
ry
If,Tb, ry
+
If
+
Jump start
инсерция
+
+
P{ry+
Δ
2-3} – P
-элемент, кодирует транспозазу
ry
Ловушка энхансеров
P{lArB}
5

3’
LacZ
ry+
PL3
Геномная ДНК
Adh
+
LacZ

β
-галактозидаза
E.coli
,
Adh
+
– алкогольдегидрогеназа дрозофилы


возможность поиска
делеций
селекцией на
потерю активности в присутствии
pentyne 3-ol
,
ry+
-
ксантиндегидрогеназа дрозофилы
,
Bluescript
-
плазмида, несет ген устойчивости к
ампицилину,
PL
1-4 - полилинкеры
PL
1
PL
2
PL
4
Bluescript
Разрезание
эндонуклеазами,
«спасение»
плазмиды,
получение
фрагмента генома
Омельянчук, 2007,
слайды к курсу «Генетика», НГУ
Инсерция Р-элемента в
геном дрозофилы.
Детекция экспрессии
репортерного гена
Имагинальные диски
окрашены на
β
-
галактозидазу
Ножные
диски
Крыловые
диски

Метод
GFP-
белковой ловушки:

a
― принцип искусственного экзона; б ―
PTT
(
protein trap transposone
):
три варианта конструкции со сдвигом рамки считывания, SA, SD ―
акцепторный и донорный сайты сплайсинга
flybase
Белок, связанный с тубулином,
маркирован
GFP
-доменом.
Глазоантеннальный имагинальный
диск
D. melanodaster
,
последовательные проекции
GFP-
белковая ловушка
+ GFP
orc

G1
G2
orc
orc

+ GFP
+ GFP
G1
G1
Явление соматического кроссинговера используют
для тестирования мутаций
+ GFP
+ GFP
orc

orc

FLP-FRT
система для искусственной
митотической рекомбинации
hs-FLP

ry+
FRT
Облучением
индуцируют
соматический
кроссинговер
FLP-FRT
система для искусственной митотической
рекомбинации
hs-FLP

ry+
При индукции
FLP
рекомбиназы происходит митотический обмен

между двумя одинаково ориентированными
FRT
сайтами

на
стадии 4-х хроматид.
Применение системы для маркирования мозаичного клона в ткани:
FRT
FRT
GFP
белок появится, если

спейсер удален.
FRT
FRT
1.
линии, содержащие
FLP
-
рекомбиназу, работающую под
промотором теплового шока
2. линии, содержащие встройки Р-
элемента с геном
white+
и
FRT
-
сайтами
промотор
GFP-
белок
Вариант:
UAS-FLP
;
GAL4
;
FRT

вводят

мутацию

+ + FRT
Orc1
необходим для
амплификации
(A-F)

Соматический клон
orc1-/- из 2-х
фолликулярных клеток
яичника

(stage11)

generated

in

WT

(A-C)

and orc1+/-

heterozygous

(D-F)
fl
ies.
GFP

(
-
/
-
)orGFP

(
+
/
+
)

clones

are

outlined.
DNA

synthesis

occurs

only

at

the speci
f
c

ampli
f
cation

loci

at

this

stage

of

oogenesis.
(G
-
J)

Histochemical

analyses

of

ORC1(G),

ORC2(H),

and

DNA(I).

A

3-cell/

somatic

clone

was

generated

in

an

orc1
+/-
heterozygote.

Note

that

ORC2

also

f
ails

to

localize

to

the

ampli
f
cation

loci

in orc1
-/-
cells.
S.Y.Park
&
M
.
Asan
o,
2008
Геномный энхансер
UAS
Тканеспецифичная
экспрессия
GAL4
Активация Гена
X
GAL4
UAS - Ген
X
GAL4
Ген X
Достоинства этой системы: можно подставлять разные драйверы под

один и тот же
UAS
-трансген и экспрессировать его в разных тканях,

введение промежуточного
GAL4
позволяет амплифицировать
(усилить) сигнал.
Gal4-UAS
система – это ловушка энхансеров,
разбитая на две части.
Омельянчук, 2007,
слайды к курсу «Генетика», НГУ
Gal4-UAS
система
Направленная экспрессии
GFP
-актина у дрозофилы.
CoG-GAL4 - экспрессия
GAL
4 в оогенезе
,
UAS GFP-
актин
Выявляется
актин в
оогенезе
дрозофилы.
Видны
кольцевые
каналы между
ооцитом и
трофоцитами,
пучки актина
Сайленсинг генов с помощью

РНК интерференции
У животных имеется защита от РНК-содержащих вирусов. При попадании

двуцепочечной РНК в клетку она фрагментируется на на 20-25 п.н. участки

под действием РНКзы Dicer2. Это явление используется для индукции

сайленсинга генов.

ген
транскрипт
белок
РНК-и конструкт
+
Dicer2
Деградация транскриптов,

белка нет.
РНК-и транскрипт
комплементарно залипает
на транскрипте гена
Омельянчук, 2007,
слайды к курсу «Генетика», НГУ
Направленный мутагенез
Под действием
FLP-
рекомбиназы

конструкция выщепляется из

хромосомы.
Искусственная
homming
нуклеаза

индуцируется с помощью
hs-I
-
SceI


конструкта и расщепляет

экстрахромосомную ДНК

по сайту
I
-
SceI:
CAAAACGTCGTGAGACAGTTTG
(рекомбиногенный разрыв).
Это приводит к рекомбинации

пробного гена (белые

прямоугольники) и гомологичной

геномной мишени (черные

прямоугольники).
Встройки находят по маркеру
w
+
Омельянчук, 2007,
слайды к курсу «Генетика», НГУ
Ловушка белок-белковых взаимодействий –
дрожжевая дигибридная система.
α
A
B
Ген репортер
Транскрипционный

фактор с сайтами
A
и
B

в плазмиде
α
Приготовим плазмиду,
c
одержащую изучаемый
белок
X
, сшитый с
фрагментом,

содержащим сайт
A.
β
A
X
A
X
Приготовим «библиотеку» всех

белков
Y
, пришитых к сайту
B
в

плазмиде
γ
γ
Y
B
Y
B
Омельянчук, 2007,
слайды к курсу «Генетика», НГУ
Клетки дрожжей трансформируют

такими концентрациями
плазмидных

ДНК, чтобы в клетку попала только одна копия
плазмиды
γ
.
α
Ген репортер
A
X
Y
B
Если белок
Y
из библиотеки

физически взаимодействует с

изучаемым белком
X
,
соберется транскрипционный фактор,
который

начнет транскрипцию гена-
репортера.
Это позволит увидеть клетки,
в которых имеются белки,

взаимодействующие с
X
.
Омельянчук, 2007,
слайды к курсу «Генетика», НГУ
Исследование взаимодействия белков с помощью
FRET
Fluorescent
Resonance
Energy
Transfer
Стволовые клетки семенника
Розетка стволовых клеток,

выявленная с помощью

антител к
vasa
Деление стволовой клетки зародышевой
линии асимметрично
Наследование центросом в делениях
стволовой клетки семенника дрозофилы

Приложенные файлы

  • pdf 3196951
    Размер файла: 763 kB Загрузок: 0

Добавить комментарий